circad | circRNAs associated with diseases

hsa_circRNA_004662
Gene	SOD2	Organism	Human
Genome Locus		Build	hg19
Disease	Papillary Thyroid Carcinoma (PTC)	ICD-10	#N/A (D09.3)
DBLink	Link to database	PMID	30123704
Experimental Method
Sample Type	Tissues	Comparison	Forty PTC and matched adjacent noncancerous tissue samples
Method for Estimation	Quantitative PCR and Microarrays	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward GAGCACGCTTACTACCTTCA Reverse CAAGCCATGTATCTTTCAGTT	Statistics	Fold Change : Upregulated,4.8 pvalue : 0.03966
Citation
Ren, H, Liu, Z, Liu, S, Zhou, X, Wang, H, Xu, J, Wang, D, Yuan, G (2018). Profile and clinical implication of circular RNAs in human papillary thyroid carcinoma. PeerJ, 6:e5363.